From 078dcda89418beb901b2520095561879db8187d1 Mon Sep 17 00:00:00 2001
From: Larry Du <larryd@23andme.com>
Date: Tue, 30 Mar 2021 10:12:14 -0700
Subject: [PATCH] Added style.css and fixed header.

---
 sequenced.md |   9 ++--
 style.css    | 120 +++++++++++++++++++++++++++++++++++++++++++++++++++
 2 files changed, 123 insertions(+), 6 deletions(-)
 create mode 100644 style.css

diff --git a/sequenced.md b/sequenced.md
index c5d7d8c..43eaf25 100644
--- a/sequenced.md
+++ b/sequenced.md
@@ -1,5 +1,4 @@
-# Assemblies of putative SARS-CoV2-spike-encoding mRNA sequences for
-vaccines BNT-162b2 and mRNA-1273. 
+# Assemblies of putative SARS-CoV2-spike-encoding mRNA sequences for vaccines BNT-162b2 and mRNA-1273.
 
 ### (version 0.1.1Beta 03/23/21)
 
@@ -16,8 +15,8 @@ the rollout of vaccines for COVID-19, these synthetic mRNAs have become broadly
 distributed RNA species in numerous human populations. Despite their ubiquity, sequences
 are not always available for such RNAs. Standard methods facilitate such sequencing. In this
 note, we provide experimental sequence informationfor the RNA components of the initial
-[Moderna](https://pubmed.ncbi.nlm.nih.gov/32756549/)and [Pfizer/BioNTech](https://pubmed.ncbi.nlm.nih.gov/33301246/) 
-COVID-19 vaccines, allowing a working assembly of the former and a confirmation of previously 
+[Moderna](https://pubmed.ncbi.nlm.nih.gov/32756549/)and [Pfizer/BioNTech](https://pubmed.ncbi.nlm.nih.gov/33301246/)
+COVID-19 vaccines, allowing a working assembly of the former and a confirmation of previously
 reported sequence information for the latter RNA.
 
 Sharing of sequence information for broadly used therapeutics has the benefit of allowing any
@@ -193,5 +192,3 @@ TTCGACGAGGACGACAGCGAGCCCGTGCTGAAGGGCGTGAAGCTGCACTACACC</span><span style="backgr
 <span style="background-color: red">Red: Stop codon(s)</span>
 <span style="background-color: magenta">Purple: 3’ UTR</span>
 <span style="background-color: blue">Blue: Start of polyA region (incomplete)</span>
-
-
diff --git a/style.css b/style.css
new file mode 100644
index 0000000..d6209ec
--- /dev/null
+++ b/style.css
@@ -0,0 +1,120 @@
+/*
+ * CSS for making a resume with pandoc. Inspired by moderncv.
+ *
+ * This CSS document is delivered to you under the CC BY-SA 3.0 License.
+ * https://creativecommons.org/licenses/by-sa/3.0/deed.en_US
+ */
+
+/* Whole document */
+body {
+    font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
+    width: 800px;
+    margin: auto;
+    background: #FFFFFF;
+    padding: 9px 9px 9px 9px;
+    font-size: 12px;
+}
+
+/* Title of the resume */
+h1 {
+    font-size: 40px;
+    color: #446fff;
+    text-align:center;
+    margin-top: 4px;
+    margin-bottom:8px;
+}
+h1:hover {
+    color: #094fff;
+    text-shadow: 1px 1px 1px #333;
+}
+
+/* Titles of categories */
+h2 {
+    color: #000000;
+    margin-bottom:3px;
+}
+h2:hover {
+    color: #094fff;
+    text-shadow: 1px 1px 1px #333;
+}
+
+/* There is a bar just before each category */
+h2:before {
+    content: "";
+    display: inline-block;
+    margin-right:1%;
+    width: 10%;
+    height: 10px;
+    background-color: #0936ff;
+}
+h3 {
+    color: #000000;
+    margin-bottom: 3px;
+}
+
+h4 {
+    margin-bottom: 2px;
+}
+
+h5{
+    color: #989898;
+    margin-top: 2px;
+    margin-botton: 3px;
+    padding: 0px;
+}
+
+/* Definitions */
+dl{
+    margin-top: 5px;
+    margin-bottom: 10px;
+}
+dt {
+    float: left;
+    clear: left;
+    width: 17%;
+    margin-bottom: 25px; /*Space out these sections*/
+    /*font-weight: bold;*/
+}
+dd {
+    margin-left: 20%;
+}
+p {
+    margin-top:0;
+    margin-bottom:3px;
+}
+
+/* Blockquotes */
+blockquote {
+    margin-top: 2px;
+    margin-bottom: 2px;
+    padding: 3px;
+    text-align: center;
+}
+
+ul{
+    padding-top: 1px;
+    padding-bottom: 1px;
+    margin-top: 0px;
+    padding-left: 4px;
+}
+
+li{
+    margin-top: 2px;
+}
+
+/* Links */
+a {
+    text-decoration: none;
+    color: #001488;
+}
+a:hover, a:active {
+    background-color: #0084ff;
+    color: #FFFFFF;
+    text-decoration: none;
+    text-shadow: 1px 1px 1px #333;
+}
+
+/* Horizontal separators */
+hr {
+    color: #A6A6A6;
+}
\ No newline at end of file